tmem188

Ensembl ID:
ENSDARG00000036064
ZFIN ID:
ZDB-GENE-050417-425
Description:
Transmembrane protein 188 [Source:UniProtKB/Swiss-Prot;Acc:Q561X0]
Human Orthologue:
TMEM188
Human Description:
transmembrane protein 188 [Source:HGNC Symbol;Acc:26759]
Mouse Orthologue:
Tmem188
Mouse Description:
transmembrane protein 188 Gene [Source:MGI Symbol;Acc:MGI:1921981]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5433 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052351 Nonsense 32 125 2 6
ENSDART00000142055 None None 93 2 6

The following transcripts of ENSDARG00000036064 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 39653302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATTGACTGAGTATGTGTCTTGTTTGCAGCCGGCTACTGGTCGTTGG[C/T]GAAGTGAGTCAGTCCAGCTTGCCTGGTCTTATATTTATTGAAATTCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nyocx3xt