ogfod1

Ensembl ID:
ENSDARG00000036061
ZFIN ID:
ZDB-GENE-030131-3294
Description:
2-oxoglutarate and iron-dependent oxygenase domain-containing protein 1 [Source:RefSeq peptide;Acc:
Human Orthologue:
OGFOD1
Human Description:
2-oxoglutarate and iron-dependent oxygenase domain containing 1 [Source:HGNC Symbol;Acc:25585]
Mouse Orthologue:
Ogfod1
Mouse Description:
2-oxoglutarate and iron-dependent oxygenase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17956 Essential Splice Site Available for shipment Available now
sa10828 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052349 Essential Splice Site 285 543 7 13
ENSDART00000129699 Essential Splice Site 263 521 7 13
Genomic Location:
Chromosome 7 (position 30440339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGCTACATTGAGCCCTCAGCTCCCCGAYACGCTCACATCCCCAGAGAYG[T/G]AAGTCAACTTGGCCTGACAGCACANTTTTTAGTGTGTGTCATGACCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052349 Splice Site, Nonsense 437 543 10 13
ENSDART00000129699 Splice Site, Nonsense 415 521 10 13
Genomic Location:
Chromosome 7 (position 30443426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCAGCACTGAAGCTGATGCTTCCTCACGTGAGAACAAGAAAGACAAA[G/T]GTGAGTACATGTGTGTATGGGTGRTGTGCTTTCAGATCAGTTCTTANATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0i9n10gz