gnao1b

Ensembl ID:
ENSDARG00000036058
ZFIN ID:
ZDB-GENE-040426-1693
Description:
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O, b [Source:
Human Orthologue:
GNAO1
Human Description:
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O [Source:HGNC
Mouse Orthologue:
Gnao1
Mouse Description:
guanine nucleotide binding protein, alpha O Gene [Source:MGI Symbol;Acc:MGI:95775]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44665 Nonsense Mutation detected in F1 DNA During 2017
sa20958 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052346 Nonsense 5 354 1 8
Genomic Location (Zv9):
Chromosome 7 (position 30470103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACAGCTGTCGCGCGTCCCGACTCTCGGTCTTGCAATGGGATGCACGT[T/A]AAGTGCAGAGGAGCGCGCGGCTCTGGATCGCAGCAGAGCCATCGAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052346 Nonsense 231 354 6 8
Genomic Location (Zv9):
Chromosome 7 (position 30477044)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28869386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTGAGGATGTGACAGCCATTATCTTCTGTGTGGCAATGAGCGGATA[C/A]GACCAAATGCTCCATGAAGATGAGACCACGGTGAAAACTACCACTCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link