irx4b

Ensembl ID:
ENSDARG00000036051
ZFIN ID:
ZDB-GENE-040712-4
Description:
iroquois homeobox protein 4b [Source:RefSeq peptide;Acc:NP_001018329]
Human Orthologue:
IRX4
Human Description:
iroquois homeobox 4 [Source:HGNC Symbol;Acc:6129]
Mouse Orthologue:
Irx4
Mouse Description:
Iroquois related homeobox 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355275]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12344 Essential Splice Site Available for shipment Available now
sa73 Nonsense Available for shipment Available now
sa23541 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052338 Essential Splice Site 95 439 2 6
ENSDART00000133354 Essential Splice Site 95 439 2 5
Genomic Location (Zv9):
Chromosome 19 (position 28743575)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28673687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGACTCCTGCAGCACTTACGGTCCAGATTCAGCCGCATGCTATCCTCTGG[T/G]AAACATTSCTTTTGTTTGTTTTATTGCTGTTCAATGATTACCTTTTGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa73
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052338 Nonsense 129 439 3 6
ENSDART00000133354 Nonsense 129 439 3 5
Genomic Location (Zv9):
Chromosome 19 (position 28744621)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28674733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGCTCTGCATATTATCCCTACGACTACCCAATTGGACAATACTCATA[T/A]GATCGATATGGGTAAGAACTGCAACCTTTTTTTTTTATTTTTTTTTTACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052338 Nonsense 262 439 5 6
ENSDART00000133354 Nonsense 262 439 5 5
Genomic Location (Zv9):
Chromosome 19 (position 28746797)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28676909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATACAGATCAACTTCACAGCGATCTGGATGATTTCGATCTAGTGGAAT[C/A]GGATGGCTCTGAGTGCGAATCGAAACCATCTTTTGTTGTGCACGTTCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link