LOC793421

Ensembl ID:
ENSDARG00000036043
Human Orthologue:
ZNF408
Human Description:
zinc finger protein 408 [Source:HGNC Symbol;Acc:20041]
Mouse Orthologue:
Zfp408
Mouse Description:
zinc finger protein 408 Gene [Source:MGI Symbol;Acc:MGI:2685857]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34129 Nonsense Mutation detected in F1 DNA During 2016
sa40962 Nonsense Mutation detected in F1 DNA During 2016
sa15177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052329 Nonsense 103 764 4 5
Genomic Location (Zv9):
Chromosome 7 (position 40139457)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38476097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGTAGAACTGCTTTCACAGGTTTGCCTGCAGTGCTCAGAGTGCAGAA[G/T]AGAGCAATGTCAGTGTACTTAAAGTGGATGGAAGACTAGGCCTTAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052329 Nonsense 684 764 5 5
Genomic Location (Zv9):
Chromosome 7 (position 40141961)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38478601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCACGATTGTTTTGGGAAAGGGAGCGGAGAAGGAGCTCGATCGGATT[G/T]AGCTCAGTGAGGACATTATTGAGATTTTTATTTCTGATGAAAACACCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052329 Nonsense 730 764 5 5
Genomic Location (Zv9):
Chromosome 7 (position 40142101)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38478741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGAACAGGAAGYTRATGCTGAATGCACAGTGGAGGCCAGYAGTGACTG[T/A]ATTGTACTCCCAGAGCAAGATGCTAATAGTTGTTTGGTCATAATCCAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link