LOC793421

Ensembl ID:
ENSDARG00000036043
Human Orthologue:
ZNF408
Human Description:
zinc finger protein 408 [Source:HGNC Symbol;Acc:20041]
Mouse Orthologue:
Zfp408
Mouse Description:
zinc finger protein 408 Gene [Source:MGI Symbol;Acc:MGI:2685857]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5434 Nonsense Mutation detected in F1 DNA During 2014
sa8277 Nonsense Mutation detected in F1 DNA During 2014
sa15177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052329 Nonsense 40 764 2 5
Genomic Location:
Chromosome 7 (position 40138511)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCAGTACCACTAGGGCTCACCGTGGGTCCATCTCTGGCTGAAGATGAA[C/T]AGCTGGGTCTGTGGTGTGTTGGGCGAGTGCTAAAGAAGGACACTCTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052329 Nonsense 324 764 5 5
Genomic Location:
Chromosome 7 (position 40140883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGGCAGGAYTTCCCTCCCTTCAAYATCCGAGAGAGGAAGTACAAATG[C/A]GAGGAGTGTGATAAAAGCTTCTTTCAACTGTGCCATCTGAAGAAACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052329 Nonsense 730 764 5 5
Genomic Location:
Chromosome 7 (position 40142101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGAACAGGAAGYTRATGCTGAATGCACAGTGGAGGCCAGYAGTGACTG[T/A]ATTGTACTCCCAGAGCAAGATGCTAATAGTTGTTTGGTCATAATCCAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bdl2gcgv