f2

Ensembl ID:
ENSDARG00000036041
ZFIN ID:
ZDB-GENE-030131-4606
Description:
prothrombin [Source:RefSeq peptide;Acc:NP_998555]
Human Orthologue:
F2
Human Description:
coagulation factor II (thrombin) [Source:HGNC Symbol;Acc:3535]
Mouse Orthologue:
F2
Mouse Description:
coagulation factor II Gene [Source:MGI Symbol;Acc:MGI:88380]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10601 Nonsense Available for shipment Available now
sa21024 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052325 Nonsense 197 635 6 14
ENSDART00000114238 Nonsense 197 539 6 14

The following transcripts of ENSDARG00000036041 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 40144853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACAAAGATGGCCCTTGGTGTTTTACCAGAGACCCGACTGTCAGGAGG[G/T]AGACCTGCAATGTGCCAAAATGYGGTAGAGAAAACTTACTAAAACATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052325 Nonsense 258 635 7 14
ENSDART00000114238 None None 539 None 14

The following transcripts of ENSDARG00000036041 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 40145642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGACTCTGGGGCTACACACCTGCCTGCAGTGGAGCTCCGCAGAAGTA[C/T]AAGCCTTGATTAAGAAGAAAGAACTTCTGCCTCAAGTTCAGCTGGTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uviebcjt