mdka

Ensembl ID:
ENSDARG00000036036
ZFIN ID:
ZDB-GENE-990621-1
Description:
midkine-related growth factor [Source:RefSeq peptide;Acc:NP_571145]
Human Orthologue:
MDK
Human Description:
midkine (neurite growth-promoting factor 2) [Source:HGNC Symbol;Acc:6972]
Mouse Orthologue:
Mdk
Mouse Description:
midkine Gene [Source:MGI Symbol;Acc:MGI:96949]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34130 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052318 Essential Splice Site 83 146 3 5
ENSDART00000124343 Essential Splice Site 83 146 2 5
ENSDART00000146635 Essential Splice Site 83 135 4 5
Genomic Location (Zv9):
Chromosome 7 (position 40566306)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38902946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAAAGTCAAATGCAGAGTGCCATGCAACTGGAAGAAAGAATTTGGAG[G/C]TGAGTTAAACTGTGGGTGATTAAAAATAGATATGGTAATCAGGTGGAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link