paqr7a

Ensembl ID:
ENSDARG00000036017
ZFIN ID:
ZDB-GENE-070705-346
Description:
similar to G protein coupled progestin receptor gamma [Source:RefSeq peptide;Acc:NP_001093530]
Human Orthologue:
PAQR7
Human Description:
progestin and adipoQ receptor family member VII [Source:HGNC Symbol;Acc:23146]
Mouse Orthologue:
Paqr7
Mouse Description:
progestin and adipoQ receptor family member VII Gene [Source:MGI Symbol;Acc:MGI:1919154]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa750 Nonsense Available for shipment Available now
sa23544 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052295 Nonsense 32 357 1 1
Genomic Location (Zv9):
Chromosome 19 (position 30413554)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14100180
KASP Assay ID:
554-0657.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAATTCCTCAGATGCTCTCCGAGACCATATCATCAATGCCCAAGACCY[T/A]GAGCGACAAAGAGGCACCTTGTTTTTTCCGCAAACRCTACATTCACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052295 Nonsense 346 357 1 1
Genomic Location (Zv9):
Chromosome 19 (position 30412613)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14099239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTTGTCATGTCTACTCTAATAGCTTTTTATATACTTGCAAAAGTAAAA[A/T]GAGCAGTCAGCAATACCGAAAAGCAAAGGAAAGAGTAATATATTCAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link