DOCK1 (3 of 3)

Ensembl ID:
ENSDARG00000036012
Description:
dedicator of cytokinesis 1 [Source:HGNC Symbol;Acc:2987]
Human Orthologue:
DOCK1
Human Description:
dedicator of cytokinesis 1 [Source:HGNC Symbol;Acc:2987]
Mouse Orthologue:
Dock1
Mouse Description:
dedicator of cytokinesis 1 Gene [Source:MGI Symbol;Acc:MGI:2429765]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22170 Nonsense Available for shipment Available now
sa28011 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052289 Nonsense 246 532 8 16
Genomic Location (Zv9):
Chromosome 12 (position 45629358)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43572131
KASP Assay ID:
2260-5733.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCGTCTGCAAAATCGGAGAAGATGCGGAAGTGCTGATGTCACTTTA[T/A]GACCCCATTGAGTCCAAGTTTATCAGGTCAGTGGTGCACACATGGACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052289 Nonsense 491 532 15 16
Genomic Location (Zv9):
Chromosome 12 (position 45678006)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43523483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTACAAATCTGTCATTTATTATCAGGTCAAACAGCCGCGCTGGTA[T/G]GAAACCATCAAGGTAAAAGTCATCTTATATTCTCCAATCTGCTGTTCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link