ube3c

Ensembl ID:
ENSDARG00000035978
ZFIN ID:
ZDB-GENE-040426-1211
Description:
ubiquitin-protein ligase E3C [Source:RefSeq peptide;Acc:NP_956767]
Human Orthologue:
UBE3C
Human Description:
ubiquitin protein ligase E3C [Source:HGNC Symbol;Acc:16803]
Mouse Orthologue:
Ube3c
Mouse Description:
ubiquitin protein ligase E3C Gene [Source:MGI Symbol;Acc:MGI:2140998]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16030 Nonsense Available for shipment Available now
sa34139 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052228 Nonsense 929 995 21 25
ENSDART00000125313 Nonsense 929 1081 20 23
ENSDART00000134547 Nonsense 929 1081 21 24
Genomic Location (Zv9):
Chromosome 7 (position 41987615)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40323925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACAGGATAGCCTACATCCATTTAGTGGCCGAKTACCGTCTRAACAAA[C/T]AGATCAGAGCACATTGCCTGGCCTTTCGACAGGGTCTGGCCAACGTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052228   None 995 23 25
ENSDART00000125313 Nonsense 1018 1081 22 23
ENSDART00000134547 Nonsense 1018 1081 23 24
Genomic Location (Zv9):
Chromosome 7 (position 41985978)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40322288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCGATGAGGAGAAACGCAAGCTGCTCAAGTTTGTCACAAGCTGCTCA[C/T]GACCTCCGCTCTTGGGCTTTAAGGTTAGTGACTTTGGCAAAAACCATGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link