ptprn2

Ensembl ID:
ENSDARG00000035970
ZFIN ID:
ZDB-GENE-030131-3758
Description:
Protein tyrosine phosphatase, receptor type, N polypeptide 2 [Source:UniProtKB/TrEMBL;Acc:A3KPJ3]
Human Orthologue:
PTPRN2
Human Description:
protein tyrosine phosphatase, receptor type, N polypeptide 2 [Source:HGNC Symbol;Acc:9677]
Mouse Orthologue:
Ptprn2
Mouse Description:
protein tyrosine phosphatase, receptor type, N polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:107418]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18156 Essential Splice Site Available for shipment Available now
sa34136 Nonsense Available for shipment Available now
sa15841 Essential Splice Site Available for shipment Available now
sa34137 Nonsense Mutation detected in F1 DNA During 2017
sa11255 Essential Splice Site Available for shipment Available now
sa15163 Nonsense Available for shipment Available now
sa30890 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222   None 650 None 16
ENSDART00000099049 Essential Splice Site 46 1027 None 23
ENSDART00000142195   46 287 2 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41659218)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39995528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGTCTGTTTGAAGATGTGTGTAAACTGAATGAAGTCTGCATCAATGG[T/C]GAGTTGTTCAAAGATTTCATTAAAATCANAACGTTGACTAGTACTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222   None 650 None 16
ENSDART00000099049 Nonsense 141 1027 5 23
ENSDART00000142195 Nonsense 161 287 5 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41708384)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40044694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGAAGGCTCAGAAAGAAGCAGCGAGCAGGACATTGCAAAGGTTCCTT[C/T]AAGGTTTCCTGCCTTCTGATGTTTCCTCCTTCAAACAGAGTCCTCAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Essential Splice Site 147 650 2 16
ENSDART00000099049 Essential Splice Site 524 1027 9 23
ENSDART00000142195   None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41714146)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40050456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTATTCAAGTCCACACGAYGGAGACTTTGGCTATATTATTACTGAAGA[G/T]TAAGTATRAAGAAAAATATTCAGATCACATRTMATTAGCAACAAAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Nonsense 174 650 3 16
ENSDART00000099049 Nonsense 551 1027 10 23
ENSDART00000142195   None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41721334)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40057644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGGAGATCTTAGCTGAGCGAGTCAGGCTTCATGTAACAGATTTCCTA[C/T]AGCTCTCGTAAGTACACACACACACACACACACACGCACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Essential Splice Site 225 650 6 16
ENSDART00000099049 Essential Splice Site 602 1027 13 23
ENSDART00000142195   None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41852907)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40189217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAATGTTTATCAGAGTNNNNNTCTCTCTCTCTTGTCTGTTTTAATTAC[A/T]GAGGGGCAAACTAAACCACATYCCCCTGGTCAAACAGAGTCARGTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Nonsense 432 650 9 16
ENSDART00000099049 Nonsense 809 1027 16 23
ENSDART00000142195   None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41866438)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40202748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATAGATGATCACTCTAGATKCATCCTGAAGCTGGAGAATAACCAATCC[A/T]GATCWGATTACATCAACGCAAGTCCTATAGTAAGTAKTTAMAGTAATTCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Nonsense 631 650 16 16
ENSDART00000099049 Nonsense 1008 1027 23 23
ENSDART00000142195   None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41891205)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40227515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTGCGTACCTGAGCTTCTTCTACTTTTCTGTCTTCAGGATCAATTT[G/T]AGTTCGCACTGACGGCTGTAGCAGAAGAGGTGAACGCCATCCTGAAAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder and schizophrenia: Case-case genome-wide association analysis shows markers differentially associated with schizophrenia and bipolar disorder and implicates calcium channel genes. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link