pgr

Ensembl ID:
ENSDARG00000035966
ZFIN ID:
ZDB-GENE-990415-214
Description:
progesterone receptor [Source:RefSeq peptide;Acc:NP_001159807]
Human Orthologue:
PGR
Human Description:
progesterone receptor [Source:HGNC Symbol;Acc:8910]
Mouse Orthologue:
Pgr
Mouse Description:
progesterone receptor Gene [Source:MGI Symbol;Acc:MGI:97567]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23367 Nonsense Available for shipment Available now
sa23368 Nonsense Available for shipment Available now
sa32215 Essential Splice Site Available for shipment Available now
sa43163 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052206 Nonsense 309 617 3 8
ENSDART00000128345 Nonsense 245 553 3 8
Genomic Location (Zv9):
Chromosome 18 (position 40225870)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41835641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCATTGTTGATAAAATCAGGAGGAAAAATTGTCCCGCATGTCGTCTT[C/T]GAAAGTGCTACCAGGCAGGGATGATGCTTGGAGGTACTGTTCATATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052206 Nonsense 412 617 4 8
ENSDART00000128345 Nonsense 348 553 4 8
Genomic Location (Zv9):
Chromosome 18 (position 40229968)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41839739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTCCTCCTCAACAGCCTCAACAGACTCTGTGAGCGTCAGCTGCTCT[G/A]GATTGTCAGATGGTCCAAATCTCTTCCAGGTAACAATTTGGCTAATCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052206 Essential Splice Site 470 617 5 8
ENSDART00000128345 Essential Splice Site 406 553 5 8
Genomic Location (Zv9):
Chromosome 18 (position 40232387)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41842158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCACCCCTGATTATCTGTATTTTGCACCCGATCTTGTCCTGAGCAA[G/A]TAAGTAAGAGTGAAAGAAATTCAATTAATTTCTGTTGTGGTTAAGACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052206 Nonsense 519 617 7 8
ENSDART00000128345 Nonsense 455 553 7 8
Genomic Location (Zv9):
Chromosome 18 (position 40236239)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41846010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTAATGTTTCAACGCTGATGTGTTTGTGACAGTTCCTCTGGAGGGCT[T/A]GAAGAGTCAAACACAGTTTGATGAAATGAGGCAGAACTACATCTGCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link