LOC562421

Ensembl ID:
ENSDARG00000035961
Human Orthologue:
KCNG2
Human Description:
potassium voltage-gated channel, subfamily G, member 2 [Source:HGNC Symbol;Acc:6249]
Mouse Orthologue:
Kcng2
Mouse Description:
potassium voltage-gated channel, subfamily G, member 2 Gene [Source:MGI Symbol;Acc:MGI:3694646]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23472 Nonsense Mutation detected in F1 DNA During 2014
sa23471 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103646 Nonsense 172 546 1 2
Genomic Location:
Chromosome 19 (position 12169435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGCTGTCGTATTGGGGTGTGGAGGAGGCCAGTTTGGAGTGGTGTTG[T/A]TTGAGAAAGCTCCGTCTGCGGCAGGAGGAGCAGCGGGAGAGACTACGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103646 Nonsense 539 546 2 2
Genomic Location:
Chromosome 19 (position 12132380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGCACTCCACCGCAGATCTGTGGCTGTGGCAAGTCAAGGAGCGCCA[C/T]AGCTGCGGAGATCACTGAAGTCATAACGCAAACAGCTGACTGTAAGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0pdyho0h