tnni2b.1

Ensembl ID:
ENSDARG00000035958
ZFIN ID:
ZDB-GENE-050417-49
Description:
troponin I, skeletal, fast 2b.1 isoform 1 [Source:RefSeq peptide;Acc:NP_001129964]
Human Orthologue:
TNNI2
Human Description:
troponin I type 2 (skeletal, fast) [Source:HGNC Symbol;Acc:11946]
Mouse Orthologue:
Tnni2
Mouse Description:
troponin I, skeletal, fast 2 Gene [Source:MGI Symbol;Acc:MGI:105070]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21031 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025852 Essential Splice Site 3 176 None 6
ENSDART00000144750 Essential Splice Site 3 176 None 7
ENSDART00000147037 Essential Splice Site 3 133 None 6

The following transcripts of ENSDARG00000035958 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 40795778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCACCTTCAGAGGGGTCGCCACAAAGAGACAGCCAAGATGTCTGAG[T/A]AAGTATTGATTTACAAACATTGTGATGTTGAGATGTGATTACTAATCCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zqi8mxxo