dync1li2

Ensembl ID:
ENSDARG00000035924
ZFIN ID:
ZDB-GENE-050417-156
Description:
cytoplasmic dynein 1 light intermediate chain 2 [Source:RefSeq peptide;Acc:NP_001017669]
Human Orthologue:
DYNC1LI2
Human Description:
dynein, cytoplasmic 1, light intermediate chain 2 [Source:HGNC Symbol;Acc:2966]
Mouse Orthologue:
Dync1li2
Mouse Description:
dynein, cytoplasmic 1 light intermediate chain 2 Gene [Source:MGI Symbol;Acc:MGI:107738]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34154 Nonsense Mutation detected in F1 DNA During 2017
sa15946 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037850 Nonsense 84 500 3 13
Genomic Location (Zv9):
Chromosome 7 (position 45690881)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44363709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACTCCAAGGAGCCGAGCACAATAAGAAAGGTAGAGGGCTGGAATA[C/A]TTGTACCTGAACGTCCAAGATGAAGACATCGATGGTAAGTGCTTTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037850 Nonsense 180 500 5 13
Genomic Location (Zv9):
Chromosome 7 (position 45679590)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44352418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTGTCCCCGTTCTGTTCTCTGCAGTGGTGAAGGCTTTCCAGRAGTA[T/A]GTAGARCCAGAAGAAGCCACACCAGGCTCACCTCAGAGACGAGCCCCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link