bzw2

Ensembl ID:
ENSDARG00000035918
ZFIN ID:
ZDB-GENE-040426-746
Description:
Basic leucine zipper and W2 domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q1LUC1]
Human Orthologue:
BZW2
Human Description:
basic leucine zipper and W2 domains 2 [Source:HGNC Symbol;Acc:18808]
Mouse Orthologue:
Bzw2
Mouse Description:
basic leucine zipper and W2 domains 2 Gene [Source:MGI Symbol;Acc:MGI:1914162]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13934 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052134 Essential Splice Site 182 421 5 11
ENSDART00000133101 Essential Splice Site 182 273 6 8
ENSDART00000136213 Essential Splice Site 182 421 7 13
ENSDART00000144337 None None 116 None 6
ENSDART00000147504 Essential Splice Site 182 203 6 7
Genomic Location:
Chromosome 19 (position 32264848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACCACCAATCCTCACCAGCCTCTTTAGCGATAATCTTGTCAAAGAAG[G/A]TTTGTGTGATCTTTRTGAGGACTTTTTTTGCATRTTACTATTTAGGGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hpnqqemf