bzw2

Ensembl ID:
ENSDARG00000035918
ZFIN ID:
ZDB-GENE-040426-746
Description:
Basic leucine zipper and W2 domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q1LUC1]
Human Orthologue:
BZW2
Human Description:
basic leucine zipper and W2 domains 2 [Source:HGNC Symbol;Acc:18808]
Mouse Orthologue:
Bzw2
Mouse Description:
basic leucine zipper and W2 domains 2 Gene [Source:MGI Symbol;Acc:MGI:1914162]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43304 Nonsense Mutation detected in F1 DNA During 2016
sa13934 Essential Splice Site Available for shipment Available now
sa39251 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052134 Nonsense 66 421 2 11
ENSDART00000133101 Nonsense 66 273 3 8
ENSDART00000136213 Nonsense 66 421 4 13
ENSDART00000144337 Nonsense 66 116 5 6
ENSDART00000147504 Nonsense 66 203 3 7
Genomic Location (Zv9):
Chromosome 19 (position 32274332)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31441621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGCCAAATTTCTGGATGTCACTGGGTCGAGACTAGACTACCGTCGCTA[T/A]GCCGACACCCTGTTTGACATCCTCATTGCTGGGAGCATGCTGGGTGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052134 Essential Splice Site 182 421 5 11
ENSDART00000133101 Essential Splice Site 182 273 6 8
ENSDART00000136213 Essential Splice Site 182 421 7 13
ENSDART00000144337   None 116 None 6
ENSDART00000147504 Essential Splice Site 182 203 6 7
Genomic Location (Zv9):
Chromosome 19 (position 32264848)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31432137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACCACCAATCCTCACCAGCCTCTTTAGCGATAATCTTGTCAAAGAAG[G/A]TTTGTGTGATCTTTRTGAGGACTTTTTTTGCATRTTACTATTTAGGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052134 Nonsense 371 421 9 11
ENSDART00000133101   None 273 None 8
ENSDART00000136213 Nonsense 371 421 11 13
ENSDART00000144337   None 116 None 6
ENSDART00000147504   None 203 None 7
Genomic Location (Zv9):
Chromosome 19 (position 32258225)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31425514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACATCCACTTCATGAAGTCCTTCTCCAAAATAGTGGTGCTCTTCTAC[A/T]AAGGTATGCCATCTCCCACCTGATCAGTGCTTTTAATGATATCTTAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link