tmem167a

Ensembl ID:
ENSDARG00000035914
ZFIN ID:
ZDB-GENE-050320-29
Description:
Protein kish-A [Source:UniProtKB/Swiss-Prot;Acc:Q5BJC2]
Human Orthologue:
TMEM167A
Human Description:
transmembrane protein 167A [Source:HGNC Symbol;Acc:28330]
Mouse Orthologues:
Gm10495, Tmem167
Mouse Descriptions:
predicted gene 10495 Gene [Source:MGI Symbol;Acc:MGI:3642611]
transmembrane protein 167 Gene [Source:MGI Symbol;Acc:MGI:1913324]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1536 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa1536
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089965 Essential Splice Site 1 72 1 4
ENSDART00000138099 None None 86 None 2
ENSDART00000148293 None None 79 1 4
Genomic Location:
Chromosome 10 (position 44597890)
KASP Assay ID:
554-1459.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATCTTACACCGGAAGTGTGAGTTGGCCGACAGGGGATAGCAAGATGG[T/C]AAGCGCAAAAGTGTTATTTTGGAGTASTTAAGAGAYGCGTGTGTAAGTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j8dk281u