yars

Ensembl ID:
ENSDARG00000035913
ZFIN ID:
ZDB-GENE-030425-2
Description:
Tyrosyl-tRNA synthetase, cytoplasmic [Source:UniProtKB/Swiss-Prot;Acc:Q6TGS6]
Human Orthologue:
YARS
Human Description:
tyrosyl-tRNA synthetase [Source:HGNC Symbol;Acc:12840]
Mouse Orthologue:
Yars
Mouse Description:
tyrosyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2147627]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23553 Essential Splice Site, Splice Site Available for shipment Available now
sa15803 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052126 Splice Site None 529 2 14
ENSDART00000124491 None None 529 1 13
ENSDART00000135484 Splice Site None 286 None 9
ENSDART00000139599 Essential Splice Site None 87 2 4
ENSDART00000140603 Splice Site None 251 2 8
ENSDART00000143394 None None 228 1 6

The following transcripts of ENSDARG00000035913 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 32130712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTCTATTACTTGACATATACACTTATAATACCTTATTTTGCACAGAA[G/A]CAGCAGACATCATGGGAGAGCAGCTGAGTCCTGATGAGAAGTTCCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052126 Nonsense 124 529 4 14
ENSDART00000124491 Nonsense 124 529 3 13
ENSDART00000135484 Nonsense 124 286 4 9
ENSDART00000139599 None None 87 None 4
ENSDART00000140603 Nonsense 124 251 4 8
ENSDART00000143394 Nonsense 124 228 3 6

The following transcripts of ENSDARG00000035913 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 32132447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTGGAGTTCCTCTTGACAAACTCAAATTTGTCAAAGGCACAGATTAT[C/T]AGCTCRGCAGGTAACCGGATGATGATTGACTGAAAATTTGTTTTACGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h34fe2jz