fam49a

Ensembl ID:
ENSDARG00000035907
ZFIN ID:
ZDB-GENE-040801-125
Description:
hypothetical protein LOC445212 [Source:RefSeq peptide;Acc:NP_001003606]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10757 Nonsense Available for shipment Available now
sa23551 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052124 Nonsense 107 323 6 12
Genomic Location:
Chromosome 19 (position 31918308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGTCTACAATCAATATGTCTTTRCAGAGAATGCCCTGCGCAGTCTTT[T/A]GGAGGCCCTAACTAGCCCACCCTMYGCTCCCATGCAGCATCTGGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052124 Essential Splice Site 303 323 12 12
Genomic Location:
Chromosome 19 (position 31926998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAACACCACATAGGCATAGCCTCAATATGTCTTTTTTTCTTTCGTTC[A/G]GGTATACGACAAGACATTTAAATGATGACAGCACCTCGAAACAAATCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ojxqaq9v