fam49a

Ensembl ID:
ENSDARG00000035907
ZFIN ID:
ZDB-GENE-040801-125
Description:
hypothetical protein LOC445212 [Source:RefSeq peptide;Acc:NP_001003606]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10757 Nonsense Available for shipment Available now
sa36862 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23551 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052124 Nonsense 107 323 6 12
Genomic Location (Zv9):
Chromosome 19 (position 31918308)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31085597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGTCTACAATCAATATGTCTTTRCAGAGAATGCCCTGCGCAGTCTTT[T/A]GGAGGCCCTAACTAGCCCACCCTMYGCTCCCATGCAGCATCTGGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052124 Essential Splice Site 210 323 8 12
Genomic Location (Zv9):
Chromosome 19 (position 31921571)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31088860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTATGCTCAAAACTTTGAGCAATGCCACAACTAAATTTGTGTCAGAG[G/A]TAAGCAATGATTTTACATCACCTTCTGTGTGAAATGGTACACTCCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052124 Essential Splice Site 303 323 12 12
Genomic Location (Zv9):
Chromosome 19 (position 31926998)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31094287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAACACCACATAGGCATAGCCTCAATATGTCTTTTTTTCTTTCGTTC[A/G]GGTATACGACAAGACATTTAAATGATGACAGCACCTCGAAACAAATCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link