crabp1b

Ensembl ID:
ENSDARG00000035904
ZFIN ID:
ZDB-GENE-040624-3
Description:
cellular retinoic acid binding protein 1b [Source:RefSeq peptide;Acc:NP_001001842]
Human Orthologue:
CRABP1
Human Description:
cellular retinoic acid binding protein 1 [Source:HGNC Symbol;Acc:2338]
Mouse Orthologue:
Crabp1
Mouse Description:
cellular retinoic acid binding protein I Gene [Source:MGI Symbol;Acc:MGI:88490]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18891 Nonsense Mutation detected in F1 DNA During 2014
sa9476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052122 Nonsense 69 137 2 4
ENSDART00000052122 Nonsense 69 137 2 4
Genomic Location:
Chromosome 7 (position 49784868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCAAGACCTCCACCACCGTCAGAACCACCGAGATCAACTTCCAGATC[G/T]GACAAGAGTTCTACGAGGAGACCGTTGATGGCCGCAAATGCAAGGTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052122 Nonsense 69 137 2 4
ENSDART00000052122 Nonsense 69 137 2 4
Genomic Location:
Chromosome 7 (position 49784868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATCAAGACCTCCAYCACYGTCAGAACCACCGWGATMAACTTCCWGATC[G/T]GACAAGAGTTCTACGAGGAGACCGTYGATGGYCGCAAATGCAAGGTGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uesuxb9t