acana

Ensembl ID:
ENSDARG00000035891
ZFIN ID:
ZDB-GENE-050208-221
Description:
Aggrecan [Source:UniProtKB/TrEMBL;Acc:Q75ZI2]
Human Orthologue:
ACAN
Human Description:
aggrecan [Source:HGNC Symbol;Acc:319]
Mouse Orthologue:
Acan
Mouse Description:
aggrecan Gene [Source:MGI Symbol;Acc:MGI:99602]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40999 Nonsense Mutation detected in F1 DNA During 2016
sa7281 Nonsense Mutation detected in F1 DNA During 2016
sa31591 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003690   None 308 None 8
ENSDART00000005288   None 287 None 7
ENSDART00000017467 Nonsense 717 1831 14 28
ENSDART00000132881   None 169 None 3
ENSDART00000147879   None 344 None 4
Genomic Location (Zv9):
Chromosome 7 (position 50234011)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48504247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAAAGTGTTACCAATATGATTTATAAAATAATTCATTAAATATTTGT[C/A]ATTTTTATATATAGAGGATCTGGATCTTCCCCTGAATGAAAGTGAATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003690   None 308 None 8
ENSDART00000005288   None 287 None 7
ENSDART00000017467 Nonsense 1241 1831 18 28
ENSDART00000132881   None 169 None 3
ENSDART00000147879   None 344 None 4
Genomic Location (Zv9):
Chromosome 7 (position 50236983)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48507219
KASP Assay ID:
554-4482.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTAGTAGTGATGTCATCTTCTTCAGCAATAATGACMTGGTGGAAATGT[C/A]AAAMAAGCCACTTCAAGGAMTGGAATTAGGAAGAGGGGAAGTGGAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003690   None 308 None 8
ENSDART00000005288   None 287 None 7
ENSDART00000017467 Essential Splice Site 1539 1831 22 28
ENSDART00000132881   None 169 None 3
ENSDART00000147879   None 344 None 4
Genomic Location (Zv9):
Chromosome 7 (position 50238040)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48508276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGTGAGTGCTGATCTGCACCTCTTAAGAGGCTTTCAAACTGATGCC[A/T]GATCAGCACTTCTACAGTAACCACAATTGACTCTAATCTCTCTATCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link