fuca1

Ensembl ID:
ENSDARG00000035890
ZFIN ID:
ZDB-GENE-030131-7434
Description:
fucosidase, alpha-L-1, tissue [Source:RefSeq peptide;Acc:NP_997905]
Human Orthologue:
FUCA1
Human Description:
fucosidase, alpha-L- 1, tissue [Source:HGNC Symbol;Acc:4006]
Mouse Orthologue:
Fuca1
Mouse Description:
fucosidase, alpha-L- 1, tissue Gene [Source:MGI Symbol;Acc:MGI:95593]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18262 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052104 Nonsense 29 451 1 8
Genomic Location:
Chromosome 19 (position 33875564)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTSTGCTATCATGCGCGTCRGTTATCGGAGCTCGATATACTCCTGACTG[G/A]ACAAGTCTGGACTCCAGACCTCTGCCTGGATGGTACGACGAGGTGAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7ce0wnkv