atp6v1c1b

Ensembl ID:
ENSDARG00000035880
ZFIN ID:
ZDB-GENE-041010-104
Description:
V-type proton ATPase subunit C 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q5XIY6]
Human Orthologue:
ATP6V1C1
Human Description:
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 [Source:HGNC Symbol;Acc:856]
Mouse Orthologue:
Atp6v1c1
Mouse Description:
ATPase, H+ transporting, lysosomal V1 subunit C1 Gene [Source:MGI Symbol;Acc:MGI:1913585]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6563 Nonsense Mutation detected in F1 DNA During 2014
sa23559 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052091 Nonsense 197 381 8 13
Genomic Location:
Chromosome 19 (position 34331787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCTCTTTTCTGTTTTATTRCCCCAAAAAGGACAAACTATCCTGAGTG[G/A]CAGAAGACGTATGAAACTCTTTCTGAAATGGTCGTTCCAAGATCAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052091 Essential Splice Site 214 381 9 13
Genomic Location:
Chromosome 19 (position 34334494)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGACAAACGCAGATTTTTGATAATGAGTTTTCATCTGCTCTTCTGTT[A/T]GGCTTTTATTCGAAGACCAAGAAAGTGGGTTGTTTAGTGTCACGCTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xixtgkec