cnn2

Ensembl ID:: ENSDARG00000035858
ZFIN ID:: ZDB-GENE-030131-542
Description:: calponin-2 [Source:RefSeq peptide;Acc:NP_998514]
Human Orthologue:: CNN2
Human Description:: calponin 2 [Source:HGNC Symbol;Acc:2156]
Mouse Orthologue:: Cnn2
Mouse Description:: calponin 2 Gene [Source:MGI Symbol;Acc:MGI:105093]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa5135	Nonsense	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa5135
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000052061	Nonsense	34	307	2	7

The following transcripts of ENSDARG00000035858 do not overlap with this mutation:

Genomic Location:: Chromosome 2 (position 23310719)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TCTTTCATTAGATTGCACAGAAATATGACCCACAGAGAGAGGAAGAATTA[C/T]GAATCTGGATTRAGAATACTACAGGGCGATCGATTGGAGACGACTTCCAG
Associated Phenotype:: Not determined

OMIM

OMIM information for CNN2

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: