cnn2

Ensembl ID:
ENSDARG00000035858
ZFIN ID:
ZDB-GENE-030131-542
Description:
calponin-2 [Source:RefSeq peptide;Acc:NP_998514]
Human Orthologue:
CNN2
Human Description:
calponin 2 [Source:HGNC Symbol;Acc:2156]
Mouse Orthologue:
Cnn2
Mouse Description:
calponin 2 Gene [Source:MGI Symbol;Acc:MGI:105093]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5135 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052061 Nonsense 34 307 2 7

The following transcripts of ENSDARG00000035858 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 23310719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCATTAGATTGCACAGAAATATGACCCACAGAGAGAGGAAGAATTA[C/T]GAATCTGGATTRAGAATACTACAGGGCGATCGATTGGAGACGACTTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iflfoz9z