gata6

Ensembl ID:
ENSDARG00000035831
ZFIN IDs:
ZDB-GENE-000622-1, ZDB-GENE-000622-1
Description:
transcription factor GATA-6 [Source:RefSeq peptide;Acc:NP_571632]
Human Orthologue:
GATA6
Human Description:
GATA binding protein 6 [Source:HGNC Symbol;Acc:4174]
Mouse Orthologue:
Gata6
Mouse Description:
GATA binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:107516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38164 Nonsense Mutation detected in F1 DNA During 2017
sa38163 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051998 Nonsense 272 501 2 7
ENSDART00000051999 Nonsense 160 383 4 11
ENSDART00000077947 Nonsense 158 382 3 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3540 (position 173762)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4367902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCGGCGTGGCCCGCGGGACCCTTCGAGAACTCCATGCTGCACTCACTG[C/T]AATCCCGAAGCGCACCGCTGGCCATCAGGGGCCCCAACGGAGGTGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051998 Essential Splice Site 412 501 5 7
ENSDART00000051999 Essential Splice Site 299 383 9 11
ENSDART00000077947 Essential Splice Site 298 382 6 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3540 (position 166241)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4375423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAGGAAAAGAAAACCAAAGTCTTTGAGCAAAGTGAAAGGATCATCTG[G/T]TATGTTTAATAATGTTCATTTAAAAGCATTCCTTCATGTGTGGTCAAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tuberculosis: Genome-wide association analyses identifies a susceptibility locus for tuberculosis on chromosome 18q11.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link