si:ch211-173p18.1

Ensembl ID:
ENSDARG00000035823
ZFIN ID:
ZDB-GENE-030131-5459
Description:
zinc finger protein 262 [Source:RefSeq peptide;Acc:NP_001037777]
Human Orthologues:
ZMYM1, ZMYM4, ZMYM6
Human Descriptions:
zinc finger, MYM-type 1 [Source:HGNC Symbol;Acc:26253]
zinc finger, MYM-type 4 [Source:HGNC Symbol;Acc:13055]
zinc finger, MYM-type 6 [Source:HGNC Symbol;Acc:13050]
Mouse Orthologues:
Zmym1, Zmym4, Zmym6
Mouse Descriptions:
zinc finger, MYM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915560]
zinc finger, MYM-type 4 Gene [Source:MGI Symbol;Acc:MGI:1915035]
zinc finger, MYM-type 6 Gene [Source:MGI Symbol;Acc:MGI:106505]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9286 Nonsense Mutation detected in F1 DNA During 2017
sa36894 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43331 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36895 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026912 Nonsense 422 525 10 12
ENSDART00000113411 Nonsense 454 1329 9 26
ENSDART00000140926 Nonsense 434 1523 10 28
Genomic Location (Zv9):
Chromosome 19 (position 41044100)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40496638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGATTCAAGCAWCCAGAACTTYTGCTCCTTTTCTTGTGTAGTGTCATA[T/G]CAGGTAAAGTGAAGCAATTTTACTAATTTCTTTCAAATCGAAATGWRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026912 Essential Splice Site 491 525 11 12
ENSDART00000113411 Essential Splice Site 523 1329 10 26
ENSDART00000140926 Essential Splice Site 503 1523 11 28
Genomic Location (Zv9):
Chromosome 19 (position 41046279)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40498817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGTCTCAACTCATTCTTCCACAAACCAGAACTGCTGGATTTTAAGG[T/C]AAAGATATCATGTATTCTTATTTATATTTGTAAAGTTGATTTATAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026912   None 525 None 12
ENSDART00000113411 Essential Splice Site 573 1329 11 26
ENSDART00000140926 Essential Splice Site 553 1523 12 28
Genomic Location (Zv9):
Chromosome 19 (position 41047146)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40499684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGAGGTGAAAAGGATCAACAAAATTGACCGATCTTTCTGCAGTGAGG[G/A]TAAGTGTTAAGAGCAAAATGAAAATGTTTGTGTTGTATGATGTATGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026912   None 525 None 12
ENSDART00000113411 Essential Splice Site 799 1329 16 26
ENSDART00000140926 Essential Splice Site 779 1523 17 28
Genomic Location (Zv9):
Chromosome 19 (position 41056014)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40508552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGGCACTTCCTGCAAACCCAATGTCTGTGACATGGATTCACAAACAG[G/A]TACTTGGAAGTACATGTTTCTAGTGAGCATTGCATATATTGACACTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link