si:ch211-173p18.3

Ensembl ID:
ENSDARG00000035821
ZFIN ID:
ZDB-GENE-060503-672
Description:
hypothetical protein LOC553317 [Source:RefSeq peptide;Acc:NP_001037785]
Human Orthologues:
ZMYM1, ZMYM4, ZMYM6
Human Descriptions:
zinc finger, MYM-type 1 [Source:HGNC Symbol;Acc:26253]
zinc finger, MYM-type 4 [Source:HGNC Symbol;Acc:13055]
zinc finger, MYM-type 6 [Source:HGNC Symbol;Acc:13050]
Mouse Orthologues:
Zmym1, Zmym4, Zmym6
Mouse Descriptions:
zinc finger, MYM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915560]
zinc finger, MYM-type 4 Gene [Source:MGI Symbol;Acc:MGI:1915035]
zinc finger, MYM-type 6 Gene [Source:MGI Symbol;Acc:MGI:106505]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32253 Nonsense Available for shipment Available now
sa11232 Essential Splice Site Available for shipment Available now
sa32254 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049968 Nonsense 248 1360 6 27
ENSDART00000143966   None 1084 None 22
Genomic Location (Zv9):
Chromosome 19 (position 41103879)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40556417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCCTTCCAGCGCAGTGGCTCTGCTAAAATCTACTGCTCACTTGAATG[T/A]CTCCGGAGCACCAAGAATAAAGCATGTCACCACTGCCTCAAGTATGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049968 Essential Splice Site 1078 1360 22 27
ENSDART00000143966 Essential Splice Site 802 1084 17 22
Genomic Location (Zv9):
Chromosome 19 (position 41117497)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40570035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACGCTGGAAAAACGCCCAACCCAACTCGGATGCTCCTAAATTTGGCTG[T/A]AAGTCTTGTTTTGCTTTTTATCCAGAATTKAATTTCTCAAATAATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049968 Nonsense 1359 1360 27 27
ENSDART00000143966 Nonsense 1083 1084 22 22
Genomic Location (Zv9):
Chromosome 19 (position 41125731)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40578269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCAAACACCCGCTGACACTGATTCAGACAGCGACTCTGACTACAAT[C/T]AGTTTTAAGACCACAAACCTGAGCTCGTCCTCTGAAGTAGTTCTGGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link