drd4b

Ensembl ID:
ENSDARG00000035820
ZFIN ID:
ZDB-GENE-070508-3
Description:
dopamine receptor D4b [Source:RefSeq peptide;Acc:NP_001012636]
Human Orthologue:
DRD4
Human Description:
dopamine receptor D4 [Source:HGNC Symbol;Acc:3025]
Mouse Orthologue:
Drd4
Mouse Description:
dopamine receptor D4 Gene [Source:MGI Symbol;Acc:MGI:94926]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2373 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2373
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051974 Nonsense 175 382 3 4
ENSDART00000133699   None 135 None 3
Genomic Location (Zv9):
Chromosome 7 (position 58686659)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57139268
KASP Assay ID:
554-3084.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTTCCCCAAAGAGACCCCAGTGAATGCAAACTCGAGGACAACAATTA[T/A]GTGGTGTATTCATCCGTCTGCTCCTTTTTTATCCCGTGCCCCATTATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link