col1a1b

Ensembl ID:
ENSDARG00000035809
ZFIN ID:
ZDB-GENE-030131-4400
Description:
collagen, type I, alpha 1b [Source:RefSeq peptide;Acc:NP_958886]
Human Orthologue:
COL1A1
Human Description:
collagen, type I, alpha 1 [Source:HGNC Symbol;Acc:2197]
Mouse Orthologue:
Col1a1
Mouse Description:
collagen, type I, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88467]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12931 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015092 Nonsense 68 1449 2 51
Genomic Location:
Chromosome 12 (position 3723840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATCTGCGTCTGCGACAGCGGGACGGTCATGTGCGACGAGGTGATCTG[C/A]GAGGATACAKCAGAYTGTGCCAATCCAGAGATTCCMGATGGAGAATGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mlssxz8c