col1a1b

Ensembl ID:
ENSDARG00000035809
ZFIN ID:
ZDB-GENE-030131-4400
Description:
collagen, type I, alpha 1b [Source:RefSeq peptide;Acc:NP_958886]
Human Orthologue:
COL1A1
Human Description:
collagen, type I, alpha 1 [Source:HGNC Symbol;Acc:2197]
Mouse Orthologue:
Col1a1
Mouse Description:
collagen, type I, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88467]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12931 Nonsense Available for shipment Available now
sa41934 Nonsense Mutation detected in F1 DNA During 2018
sa45443 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015092 Nonsense 68 1449 2 51
Genomic Location (Zv9):
Chromosome 12 (position 3723840)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3097360
GRCz11 12 3132093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATCTGCGTCTGCGACAGCGGGACGGTCATGTGCGACGAGGTGATCTG[C/A]GAGGATACAKCAGAYTGTGCCAATCCAGAGATTCCMGATGGAGAATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015092 Nonsense 578 1449 26 51
Genomic Location (Zv9):
Chromosome 12 (position 3712627)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3086147
GRCz11 12 3120880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTACCAACTGCTTGATATTCACATATATTTGTTATTCCTTTTAGGGT[G/T]AGAGTGGTAAACCTGGTGAGAGAGGACTTGCTGGACCTACTGGCCCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015092 Essential Splice Site 786 1449 34 51
Genomic Location (Zv9):
Chromosome 12 (position 3706423)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3079943
GRCz11 12 3114676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGGTGCTGTTGGACCCCCAGGATTGACTGGACCTCGTGGAGGCCCTG[T/A]AAGTTATTACAGAAATTAAATATCTTGAAACATAGACATAAGGAGCAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link