LOC567602

Ensembl ID:
ENSDARG00000035796
Human Orthologues:
CDH1, CDH3
Human Descriptions:
cadherin 1, type 1, E-cadherin (epithelial) [Source:HGNC Symbol;Acc:1748]
cadherin 3, type 1, P-cadherin (placental) [Source:HGNC Symbol;Acc:1762]
Mouse Orthologues:
Cdh1, Cdh3
Mouse Descriptions:
cadherin 1 Gene [Source:MGI Symbol;Acc:MGI:88354]
cadherin 3 Gene [Source:MGI Symbol;Acc:MGI:88356]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16568 Nonsense Available for shipment Available now
sa41033 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002834 Nonsense 179 746 4 13
Genomic Location (Zv9):
Chromosome 7 (position 56394303)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54880386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATACTTTTWAYGCTGATGTCAGATACAAAATTGTYAGCCAAGAWCCAK[T/A]ATTACCAAATCCAAACATGTTTGAAATYAACTTGGTTACTGGAGGAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002834 Nonsense 394 746 8 13
Genomic Location (Zv9):
Chromosome 7 (position 56388627)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54886062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAATTGCTTCACAAAAATTATATTTTTTACTGTTTGGTTCCAGGTAT[A/T]AAATTAGCAATGATCCTGCTGGCTGGCTAACTGTGAATCGGGAGACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of genome-wide association data identifies four new susceptibility loci for colorectal cancer. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link