LOC567602

Ensembl ID:
ENSDARG00000035796
Human Orthologues:
CDH1, CDH3
Human Descriptions:
cadherin 1, type 1, E-cadherin (epithelial) [Source:HGNC Symbol;Acc:1748]
cadherin 3, type 1, P-cadherin (placental) [Source:HGNC Symbol;Acc:1762]
Mouse Orthologues:
Cdh1, Cdh3
Mouse Descriptions:
cadherin 1 Gene [Source:MGI Symbol;Acc:MGI:88354]
cadherin 3 Gene [Source:MGI Symbol;Acc:MGI:88356]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16568 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002834 Nonsense 179 746 4 13
Genomic Location:
Chromosome 7 (position 56394303)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATACTTTTWAYGCTGATGTCAGATACAAAATTGTYAGCCAAGAWCCAK[T/A]ATTACCAAATCCAAACATGTTTGAAATYAACTTGGTTACTGGAGGAATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of genome-wide association data identifies four new susceptibility loci for colorectal cancer. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/itpihl92