si:busm1-71b9.3

Ensembl ID:
ENSDARG00000035791
ZFIN ID:
ZDB-GENE-041001-54
Description:
Si:busm1-71b9.3 protein [Source:UniProtKB/TrEMBL;Acc:Q3B7G9]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1028 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1028
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043087 Nonsense 51 453 2 9
Genomic Location (Zv9):
Chromosome 7 (position 56153062)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52901448
KASP Assay ID:
554-0932.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTTTAAAGTCCACAAAGATCACCTTCACAGGGGAGAGAGACTCGGA[A/T]GAGGTAAGCGGTTTTCTCCTGTCAATAGAAGYGGCTAAACATTGAGCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link