chrna7

Ensembl ID:
ENSDARG00000035785
ZFIN ID:
ZDB-GENE-040108-3
Description:
neuronal acetylcholine receptor subunit alpha-7 [Source:RefSeq peptide;Acc:NP_957513]
Human Orthologues:
CHRFAM7A, CHRNA7
Human Descriptions:
cholinergic receptor, nicotinic, alpha 7 [Source:HGNC Symbol;Acc:1960]
CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence simila
Mouse Orthologue:
Chrna7
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 7 Gene [Source:MGI Symbol;Acc:MGI:99779]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21086 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21087 Nonsense Available for shipment Available now
sa2371 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051931 Essential Splice Site 199 509 6 10
ENSDART00000134733 Essential Splice Site 200 510 5 9
Genomic Location:
Chromosome 7 (position 55674791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGCCGACATCACAGGATACATTGCTAATGGAGAGTGGGACCTTGTGG[G/A]TAGGGTGACCGACTTCATTAAATACCAATGCTTGAACAGAAGATAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051931 Nonsense 233 509 7 10
ENSDART00000134733 Nonsense 234 510 6 9
Genomic Location:
Chromosome 7 (position 55675268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCAGATGTGACTTTTACGGTGGTGATGCGGAGACGAACACTGTATTA[C/A]GGTCTTAATCTACTTATTCCCTGTGTGCTCATCTCTACTCTGGCCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051931 Nonsense 448 509 10 10
ENSDART00000134733 Nonsense 449 510 9 9
Genomic Location:
Chromosome 7 (position 55682640)
KASP Assay ID:
554-3029.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGCCCTGGAGAAACCGAACTKTCCAAGATCTTGGATGAGGTGCGGTA[C/A]ATTTCCAAGCGCTTTCGGGACCAAGACGAGGAAGACACTGTGTGTAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f9edz8cq