pltp

Ensembl ID:
ENSDARG00000035768
ZFIN ID:
ZDB-GENE-040801-22
Description:
phospholipid transfer protein [Source:RefSeq peptide;Acc:NP_001003519]
Human Orthologue:
PLTP
Human Description:
phospholipid transfer protein [Source:HGNC Symbol;Acc:9093]
Mouse Orthologue:
Pltp
Mouse Description:
phospholipid transfer protein Gene [Source:MGI Symbol;Acc:MGI:103151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20831 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051901 Essential Splice Site 429 486 14 16
Genomic Location (Zv9):
Chromosome 6 (position 55588214)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55376840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCCCCTGAAGACCATGCTGCAGATATCTGTGGTGCCTCTCATTAACA[G/A]TAAGTGATAGGACATGTCAGCACAGGCTTCCTGTGGGTCTCTATAAAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link