mcm7

Ensembl ID:
ENSDARG00000035761
ZFIN ID:
ZDB-GENE-020419-27
Description:
DNA replication licensing factor MCM7 [Source:RefSeq peptide;Acc:NP_997734]
Human Orthologue:
MCM7
Human Description:
minichromosome maintenance complex component 7 [Source:HGNC Symbol;Acc:6950]
Mouse Orthologue:
Mcm7
Mouse Description:
minichromosome maintenance deficient 7 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1298398]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42318 Nonsense Mutation detected in F1 DNA During 2017
sa44797 Nonsense Mutation detected in F1 DNA During 2017
sa11737 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051890 Nonsense 72 721 3 15
Genomic Location (Zv9):
Chromosome 14 (position 211030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGGAAGAAGACCCGGATCTGGTGGAGAGTGTGTGTGAGAACGCCAAA[C/T]GATACACAGCGCTGTTTGCAGACGCCATTCATGAGCTGCTGCCGGAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051890 Nonsense 580 721 13 15
Genomic Location (Zv9):
Chromosome 14 (position 205904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAGTGTAAGCAGAAGCAGCCGGTGGTGCCGGAGTCTCTGTCGGACTA[C/A]ATCACTGCGGCGTATGTGGAGATGCGGAAGGAGGCGCGGGTCAGTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051890 Nonsense 709 721 15 15
Genomic Location (Zv9):
Chromosome 14 (position 201590)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 158218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCGCAGTTCCAGGCGGCGCTGCAGGAGTACGAGGAGCTGAACGTGTG[G/A]CAGATCAACCAGGCCCGYACACGCATCACATTCGTCTAACACGTATGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link