mcm7

Ensembl ID:
ENSDARG00000035761
ZFIN ID:
ZDB-GENE-020419-27
Description:
DNA replication licensing factor MCM7 [Source:RefSeq peptide;Acc:NP_997734]
Human Orthologue:
MCM7
Human Description:
minichromosome maintenance complex component 7 [Source:HGNC Symbol;Acc:6950]
Mouse Orthologue:
Mcm7
Mouse Description:
minichromosome maintenance deficient 7 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1298398]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42318 Nonsense Mutation detected in F1 DNA During 2016
sa11737 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051890 Nonsense 72 721 3 15
Genomic Location (Zv9):
Chromosome 14 (position 211030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGGAAGAAGACCCGGATCTGGTGGAGAGTGTGTGTGAGAACGCCAAA[C/T]GATACACAGCGCTGTTTGCAGACGCCATTCATGAGCTGCTGCCGGAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051890 Nonsense 709 721 15 15
Genomic Location (Zv9):
Chromosome 14 (position 201590)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 158218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCGCAGTTCCAGGCGGCGCTGCAGGAGTACGAGGAGCTGAACGTGTG[G/A]CAGATCAACCAGGCCCGYACACGCATCACATTCGTCTAACACGTATGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link