ipo7

Ensembl ID:
ENSDARG00000035751
ZFIN ID:
ZDB-GENE-030131-458
Description:
importin-7 [Source:RefSeq peptide;Acc:NP_957199]
Human Orthologue:
IPO7
Human Description:
importin 7 [Source:HGNC Symbol;Acc:9852]
Mouse Orthologue:
Ipo7
Mouse Description:
importin 7 Gene [Source:MGI Symbol;Acc:MGI:2152414]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31613 Nonsense Available for shipment Available now
sa21124 Nonsense Available for shipment Available now
sa7608 Missense Mutation detected in F1 DNA During 2017
sa34228 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051879 Nonsense 113 347 4 9
ENSDART00000108471 Nonsense 113 1039 4 25
ENSDART00000113602 Nonsense 113 772 4 19
Genomic Location (Zv9):
Chromosome 7 (position 66999986)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64914970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTTCCCTCCTCTCTTCTCTTTCCTAGAGTGCAACTCACAACTTG[C/A]ATTCACCACATGATTAAGCACGACTACCCCGGTAGATGGACAGCTATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051879 Nonsense 135 347 4 9
ENSDART00000108471 Nonsense 135 1039 4 25
ENSDART00000113602 Nonsense 135 772 4 19
Genomic Location (Zv9):
Chromosome 7 (position 67000051)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64915035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCACGACTACCCCGGTAGATGGACAGCTATAGTGGACAAGATTGGCT[T/A]GTATCTGCAGTCTGATAACAGTTCCTACTGGCTGGGCATCCTGCTGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051879   None 347 None 9
ENSDART00000108471 Missense 960 1039 23 25
ENSDART00000113602 Missense 693 772 17 19
Genomic Location (Zv9):
Chromosome 7 (position 67030820)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64945804
KASP Assay ID:
554-4068.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGGTTACACRACCTTAGTGGACGATGAAGACAACCTCGTAGATGAA[T/A]ACCAGATCTTCAAAGCCATAATGCAGAGTATGGGTTGTTTTATGTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051879   None 347 None 9
ENSDART00000108471 Nonsense 1013 1039 25 25
ENSDART00000113602 Nonsense 746 772 19 19
Genomic Location (Zv9):
Chromosome 7 (position 67033398)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64948382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGTGCTTATTTTCCCTTTATTTTATGTTTTTAGAATCAAAGATGATC[G/T]AGAAACACGGAGGATACAAGTTCACAGCACCCGTGGTGCCATCCAGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link