ccnd1

Ensembl ID:
ENSDARG00000035750
ZFIN ID:
ZDB-GENE-980526-176
Description:
G1/S-specific cyclin-D1 [Source:UniProtKB/Swiss-Prot;Acc:Q90459]
Human Orthologue:
CCND1
Human Description:
cyclin D1 [Source:HGNC Symbol;Acc:1582]
Mouse Orthologue:
Ccnd1
Mouse Description:
cyclin D1 Gene [Source:MGI Symbol;Acc:MGI:88313]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21083 Nonsense Mutation detected in F1 DNA During 2014
sa14707 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051868 Nonsense 38 291 1 5
Genomic Location:
Chromosome 7 (position 54577704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGAATGACCGAGTTTTACAGACAATGCTTAAAGCTGAGGAAAACTA[T/A]CTCCCATCACCAAATTATTTCAAGTGTGTTCAGAAAGAAATTGTGCCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051868 Essential Splice Site 138 291 2 5
Genomic Location:
Chromosome 7 (position 54579403)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTTGTGCATATACACGGACAACTCTGTCCGTCCCGGCGAATTATTGG[T/A]AAATRYTTAATACTCTTTAATTTAGCAGCTTGATATTKTTTTCTTTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: Genome-wide association study identifies five new breast cancer susceptibility loci. (View Study)
  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5v8obvt1