gsx1

Ensembl ID:
ENSDARG00000035735
ZFIN ID:
ZDB-GENE-041008-135
Description:
GS homeobox 1 [Source:RefSeq peptide;Acc:NP_001012251]
Human Orthologue:
GSX1
Human Description:
GS homeobox 1 [Source:HGNC Symbol;Acc:20374]
Mouse Orthologue:
Gsx1
Mouse Description:
GS homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:95842]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33771 Essential Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051833 Nonsense 192 243 2 2
ENSDART00000124890 Essential Splice Site 192 222 2 3
Genomic Location (Zv9):
Chromosome 5 (position 71058246)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67232653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCGAGAAGCAAGTCAAGATTTGGTTCCAGAACCGCCGCGTAAAGCAC[A/T]AAAAAGAAGGCAAAAGCGGCTCCCACAGAACGGGCGCGCACAACTGCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link