arntl1b

Ensembl ID:
ENSDARG00000035732
ZFIN ID:
ZDB-GENE-030408-1
Description:
aryl hydrocarbon receptor nuclear translocator-like 1b [Source:RefSeq peptide;Acc:NP_840085]
Human Orthologue:
ARNTL
Human Description:
aryl hydrocarbon receptor nuclear translocator-like [Source:HGNC Symbol;Acc:701]
Mouse Orthologue:
Arntl
Mouse Description:
aryl hydrocarbon receptor nuclear translocator-like Gene [Source:MGI Symbol;Acc:MGI:1096381]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1146 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051823 Nonsense 180 623 9 19
ENSDART00000098259 Nonsense 203 646 10 20
ENSDART00000104523 Nonsense 202 645 10 20
ENSDART00000139227 Nonsense 179 622 7 17

The following transcripts of ENSDARG00000035732 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 67965083)
KASP Assay ID:
554-1057.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTGGGCTGCGATCGGGGGAAGATCCTTTTTGTCTCAGAGTCTGTCTA[C/A]AAAATTCTAAATTACAGTCAGGTAAATACTACGTCATGATATGATGCATA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/54htez3n