lhb

Ensembl ID:
ENSDARG00000035709
ZFIN ID:
ZDB-GENE-040806-2
Description:
luteinizing hormone, beta polypeptide [Source:RefSeq peptide;Acc:NP_991185]
Human Orthologues:
CGB, CGB1, CGB2, CGB5, CGB7, CGB8, LHB
Human Descriptions:
chorionic gonadotropin, beta polypeptide 1 [Source:HGNC Symbol;Acc:16721]
chorionic gonadotropin, beta polypeptide 2 [Source:HGNC Symbol;Acc:16722]
chorionic gonadotropin, beta polypeptide 5 [Source:HGNC Symbol;Acc:16452]
chorionic gonadotropin, beta polypeptide 7 [Source:HGNC Symbol;Acc:16451]
chorionic gonadotropin, beta polypeptide 8 [Source:HGNC Symbol;Acc:16453]
chorionic gonadotropin, beta polypeptide [Source:HGNC Symbol;Acc:1886]
luteinizing hormone beta polypeptide [Source:HGNC Symbol;Acc:6584]
Mouse Orthologue:
Lhb
Mouse Description:
luteinizing hormone beta Gene [Source:MGI Symbol;Acc:MGI:96782]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30366 Nonsense Mutation detected in F1 DNA During 2017
sa44382 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051787 Nonsense 113 140 3 3
Genomic Location (Zv9):
Chromosome Zv9_scaffold3525 (position 55819)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2394160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCGCAGATCACATACCCGGTGGCGCTGAGCTGCGACTGCAGTCTGTG[C/A]ACCATAAACACTTCCGACTGCACCATCCAGAGCCTGCAGCCCGACTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051787 Nonsense 133 140 3 3
Genomic Location (Zv9):
Chromosome Zv9_scaffold3525 (position 55761)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2394218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTCCGACTGCACCATCCAGAGCCTGCAGCCCGACTTCTGCATGTCC[C/T]AGAGAGAGGATTTCCCCGCATACTAGACCTCGGACAACTCACATCAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link