DOCK6

Ensembl ID:
ENSDARG00000035706
Description:
dedicator of cytokinesis 6 [Source:HGNC Symbol;Acc:19189]
Human Orthologue:
DOCK6
Human Description:
dedicator of cytokinesis 6 [Source:HGNC Symbol;Acc:19189]
Mouse Orthologue:
Dock6
Mouse Description:
dedicator of cytokinesis 6 Gene [Source:MGI Symbol;Acc:MGI:1914789]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1010 Nonsense Available for shipment Available now
sa40178 Nonsense Mutation detected in F1 DNA During 2017
sa6922 Nonsense Mutation detected in F1 DNA During 2017
sa26161 Nonsense Mutation detected in F1 DNA During 2017
sa12512 Nonsense Available for shipment Available now
sa33330 Nonsense Mutation detected in F1 DNA During 2017
sa899 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082944 Nonsense 271 2114 8 50
Genomic Location (Zv9):
Chromosome 3 (position 56154393)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55048119
KASP Assay ID:
554-0914.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGCTGCCTGCAGTCTGTTCTGACCTGTTGCGGTTGTATTTCCAGATTC[G/T]AGATTGAAATCGAGCCAATATTTGGATCACTGGCTCTGTATGATGTTAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082944 Nonsense 422 2114 12 50
Genomic Location (Zv9):
Chromosome 3 (position 56146183)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55039909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATAAAACGGTTCTCTAGCTGAAACATCATTCTGTCATTCCCTTCAGAG[C/T]GAAAGGGGACGTGGAATGAGAGGAAGAAGAAGGGATTTGAAAGGATGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082944 Nonsense 564 2114 15 50
Genomic Location (Zv9):
Chromosome 3 (position 56136548)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55030274
KASP Assay ID:
554-4685.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGAACTTGCTGTACGTTTACCCTCAGTCCGTGAACTTCAGCAGCCGG[C/T]AGGGTTCGGTGAGGAACATTGCTGTGAAGGTGCAGTTCATGGCAGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082944 Nonsense 940 2114 23 50
Genomic Location (Zv9):
Chromosome 3 (position 56118208)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55011934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGGGGGCTCGAGGGCCGTGCTCCGCCGGAACCCCAACTCGAGCTG[T/A]GAGCTCAAGCAGGTGCCGATCAATCCCTATAACCTAATGTCCCGCTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082944 Nonsense 1322 2114 32 50
Genomic Location (Zv9):
Chromosome 3 (position 56101351)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54995077
KASP Assay ID:
2259-4178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTCCTCTCAGCGGAGTGCAGCAGGACGCTGCTGGTGTGTTTTCTGTG[G/A]GTCTGGAAGAACGCTGATGCAGGRCTGCTGGAGCGATGGGTTTCAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082944 Nonsense 1360 2114 32 50
Genomic Location (Zv9):
Chromosome 3 (position 56101237)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54994963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAACCGTCTGCTGGATCTGCTCCACCTCTGTCTGTCCTGTTTCGAATA[C/A]AAGGTACATTAACACATGTTCCCTGTTGATCAGGATGGATTTGATAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082944 Essential Splice Site 1403 2114 33 50
Genomic Location (Zv9):
Chromosome 3 (position 56096347)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54990073
KASP Assay ID:
554-0806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACTGGGCACTATTGGAGCAAGACAAGAGATGGTCCGCCGCTGCAGAG[G/A]TACAAACACACACTTTCTTGCTTTATATGCAAGAAAAACGTGAAAAGGYA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link