scxa

Ensembl ID:
ENSDARG00000035695
ZFIN ID:
ZDB-GENE-060503-414
Description:
scleraxis homolog A [Source:RefSeq peptide;Acc:NP_001076538]
Human Orthologues:
SCXA, SCXB
Human Descriptions:
scleraxis homolog A (mouse) [Source:HGNC Symbol;Acc:24312]
scleraxis homolog B (mouse) [Source:HGNC Symbol;Acc:32322]
Mouse Orthologue:
Scx
Mouse Description:
scleraxis Gene [Source:MGI Symbol;Acc:MGI:102934]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36755 Nonsense Mutation detected in F1 DNA During 2017
sa23414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105192 Nonsense 50 204 1 2
ENSDART00000145363 Nonsense 45 199 1 2
Genomic Location (Zv9):
Chromosome 19 (position 3564418)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3060991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTCGGATGATCGCTCATTTCACCTGGACACTTCAGGGTATGATCTT[A/T]AAGTTGGAAGAAAGAGGAAATCCAGTGTAGGGGGTGGCGGACGGCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105192 Nonsense 155 204 1 2
ENSDART00000145363 Nonsense 150 199 1 2
Genomic Location (Zv9):
Chromosome 19 (position 3564733)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3061306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGCTGCTGGTGGGTGAAGCTTGCGGAGATGGACAGCCGTGCCACAGC[G/T]GAGGACCCTCCACCTCAAACTACTACCACCACCACGGCTCACCCAGCCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link