si:dkey-161m5.2

Ensembl ID:
ENSDARG00000035686
ZFIN ID:
ZDB-GENE-081104-318
Description:
Novel protein similar to vertebrate MON1 homolog B (Yeast) (MON1B) [Source:UniProtKB/TrEMBL;Acc:B0UY
Human Orthologue:
MON1B
Human Description:
MON1 homolog B (yeast) [Source:HGNC Symbol;Acc:25020]
Mouse Orthologue:
Mon1b
Mouse Description:
MON1 homolog b (yeast) Gene [Source:MGI Symbol;Acc:MGI:1923231]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34311 Nonsense Mutation detected in F1 DNA During 2017
sa41127 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051756 Nonsense 170 502 2 4
ENSDART00000132031 Nonsense 170 474 3 5
Genomic Location (Zv9):
Chromosome 8 (position 10234766)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9651348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTTACACAGGCCAGCATAAAACGCATCTTTGAGCACCGCAAGAACTA[T/G]GACCTGCGGCGCCTGCTGTTTGGCTCTGAGAGGGTCCTGGACAGCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051756 Nonsense 338 502 2 4
ENSDART00000132031 Nonsense 338 474 3 5
Genomic Location (Zv9):
Chromosome 8 (position 10235270)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9651852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAACGGAAAATCGAGCAAGCTTTCATGTCTCAGAATGCCTTGGAGTG[T/A]GTGGCAAACAGTCAGATGTACTGTGTTGAGGATGTCGGTGTAAATAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link