ltbp3

Ensembl ID:
ENSDARG00000035682
ZFIN ID:
ZDB-GENE-060526-130
Description:
Novel protein similar to latent transforming growth factor [Source:UniProtKB/TrEMBL;Acc:A2BFE2]
Human Orthologue:
LTBP3
Human Description:
latent transforming growth factor beta binding protein 3 [Source:HGNC Symbol;Acc:6716]
Mouse Orthologue:
Ltbp3
Mouse Description:
latent transforming growth factor beta binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1101355]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40507 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20482 Nonsense Mutation detected in F1 DNA During 2016
sa20483 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048107 Essential Splice Site 256 1266 7 33
Genomic Location:
Chromosome 5 (position 39156447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATGATGAGGTGCTTCAGCAGCTGAAATTCCTCTGATTTCTGTCATTC[A/T]GATACTGAAAAACACCAGGCTATAGTCGAGGACTTTGCATCAACGTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048107 Nonsense 394 1266 10 33
Genomic Location:
Chromosome 5 (position 39163333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTAATAAGATATGTCCAGCAGGAAAGGGAATGTCTTTACAGACCTA[T/A]CACGGTACTCTGACCTTTCAGCCCTTCCTGACCAGCATTGAACACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048107 Nonsense 785 1266 22 33
Genomic Location:
Chromosome 5 (position 39170525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGTCTCTGTCAGCCGCACGGCGTATGTGAAAACCGACAAGGTGGATA[C/A]GTGTGCGTGTGCAACGATGGTTTCAGACTGTCTGAAGACAAACACAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link