ltbp3

Ensembl ID:
ENSDARG00000035682
ZFIN ID:
ZDB-GENE-060526-130
Description:
Novel protein similar to latent transforming growth factor [Source:UniProtKB/TrEMBL;Acc:A2BFE2]
Human Orthologue:
LTBP3
Human Description:
latent transforming growth factor beta binding protein 3 [Source:HGNC Symbol;Acc:6716]
Mouse Orthologue:
Ltbp3
Mouse Description:
latent transforming growth factor beta binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1101355]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20482 Nonsense Mutation detected in F1 DNA During 2014
sa20483 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048107 Nonsense 394 1266 10 33
Genomic Location:
Chromosome 5 (position 39163333)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTAATAAGATATGTCCAGCAGGAAAGGGAATGTCTTTACAGACCTA[T/A]CACGGTACTCTGACCTTTCAGCCCTTCCTGACCAGCATTGAACACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048107 Nonsense 785 1266 22 33
Genomic Location:
Chromosome 5 (position 39170525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGTCTCTGTCAGCCGCACGGCGTATGTGAAAACCGACAAGGTGGATA[C/A]GTGTGCGTGTGCAACGATGGTTTCAGACTGTCTGAAGACAAACACAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g3tr0m3x