bmp8a

Ensembl ID:
ENSDARG00000035677
ZFIN ID:
ZDB-GENE-030912-13
Description:
bone morphogenetic protein 8A [Source:RefSeq peptide;Acc:NP_001038436]
Human Orthologues:
BMP8A, BMP8B
Human Descriptions:
bone morphogenetic protein 8a [Source:HGNC Symbol;Acc:21650]
bone morphogenetic protein 8b [Source:HGNC Symbol;Acc:1075]
Mouse Orthologues:
Bmp8a, Bmp8b
Mouse Descriptions:
bone morphogenetic protein 8a Gene [Source:MGI Symbol;Acc:MGI:104515]
bone morphogenetic protein 8b Gene [Source:MGI Symbol;Acc:MGI:107335]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10778 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103253 Nonsense 278 433 4 7
Genomic Location:
Chromosome 19 (position 36572020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACAGGTCWTGGGTGGGTCTGGTGGGTCGGCGTGGGCCTCGCTCTAAG[C/T]AGCCGTTCATGGTGACGTTCTTCAGAGCTAGTCAAGCCCCTTGCCGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5527k7e5