si:ch211-193k19.1

Ensembl ID:
ENSDARG00000035660
ZFIN ID:
ZDB-GENE-060503-110
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L9B7]
Human Orthologue:
KIAA0319L
Human Description:
KIAA0319-like [Source:HGNC Symbol;Acc:30071]
Mouse Orthologue:
AU040320
Mouse Description:
expressed sequence AU040320 Gene [Source:MGI Symbol;Acc:MGI:2140475]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13528 Nonsense Available for shipment Available now
sa43340 Nonsense Mutation detected in F1 DNA During 2017
sa3023 Essential Splice Site F2 line generated During 2017
sa9917 Essential Splice Site Available for shipment Available now
sa19220 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36911 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051723 Nonsense 68 951 2 20
ENSDART00000139151   None 764 None 17
Genomic Location (Zv9):
Chromosome 19 (position 44902350)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44085705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGTCATCGGTCTGGGCTGGCAGCCGCTGGCGGTGGACCAGGGAGGGT[C/A]ACGCTGCYGGGAGWCCTGCTGTTTGGAGCCGTCCTGCGGGGCCGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051723 Nonsense 90 951 2 20
ENSDART00000139151   None 764 None 17
Genomic Location (Zv9):
Chromosome 19 (position 44902283)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44085772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTTTGGAGCCGTCCTGCGGGGCCGTGTGGAGCCTCGGCGGACGCTG[T/A]GTGCTGTTGGCCTGCTCTCAGAGGGAAACCTGCGGCATCTCGTCTCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3023
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051723 Essential Splice Site 204 951 4 20
ENSDART00000139151   None 764 None 17
Genomic Location (Zv9):
Chromosome 19 (position 44897143)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44090912
KASP Assay ID:
554-3269.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGAATCKGGGTCTTGGTTATAAAACTTTTCTRAAAACTTTTGTTTCA[T/A]GTAACAGTGCGAGAGCTGGTCGTCKCTGCTGGCCAAAATGTGGAGGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051723 Essential Splice Site 271 951 5 20
ENSDART00000139151 Essential Splice Site 66 764 2 17
Genomic Location (Zv9):
Chromosome 19 (position 44896670)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44091385
KASP Assay ID:
2261-3683.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGGAGAAATGGAGGRTAAACAYASCATGACACYTAAGCTGAGTAAGG[T/C]AAATAGAATATGAAGAGTTTAGATRCAAAAACCCATAAATGCCATCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051723 Essential Splice Site 738 951 16 20
ENSDART00000139151 Essential Splice Site 551 764 13 17
Genomic Location (Zv9):
Chromosome 19 (position 44879368)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44108687
KASP Assay ID:
2261-3682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATAATAAAATTAAGTCTGAGTTTATGACATTATTTCTTATTTTTTCA[G/A]CACTCGTCTGGTATTTCTGGTATCAGGAGGTCCAGGAAGGCCTCCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051723 Nonsense 947 951 20 20
ENSDART00000139151 Nonsense 760 764 17 17
Genomic Location (Zv9):
Chromosome 19 (position 44876937)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44111118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACGGATCTCTACGTAACGGCCAGGGTCCACATAAACCTAAAAAAACA[C/T]GAGAGGAGCTGCTTTAGCACGGCTCCCGTACTGCACCAACACACTGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link