si:ch211-246f9.1

Ensembl ID:
ENSDARG00000035655
ZFIN ID:
ZDB-GENE-060503-223
Description:
RAD21 homolog [Source:RefSeq peptide;Acc:NP_001038585]
Human Orthologue:
RAD21
Human Description:
RAD21 homolog (S. pombe) [Source:HGNC Symbol;Acc:9811]
Mouse Orthologue:
Rad21
Mouse Description:
RAD21 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:108016]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14114 Essential Splice Site Available for shipment Available now
sa10727 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Essential Splice Site 230 637 5 13
ENSDART00000132800 Essential Splice Site 230 637 6 14
Genomic Location (Zv9):
Chromosome 19 (position 45588408)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44486630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGACTTTGGAGACAATCCAATGGAGAGCACTGAAGGAGGCATGCTGG[G/A]TAATAGAGGCATCTATAATATYCYCCGMTGTATAGGCTTTRTGTGGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Nonsense 310 637 7 13
ENSDART00000132800 Nonsense 310 637 8 14
Genomic Location (Zv9):
Chromosome 19 (position 45584354)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44482576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGACTGAACAGACCACACTAGWCCACAATGAAGAGGAGGCCTTTGCTT[T/A]GGAGCCCATCGACATCAMAGGTCAGTCAGAAGAGAAAAGTAGTWGCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link