si:ch211-246f9.1

Ensembl ID:
ENSDARG00000035655
ZFIN ID:
ZDB-GENE-060503-223
Description:
RAD21 homolog [Source:RefSeq peptide;Acc:NP_001038585]
Human Orthologue:
RAD21
Human Description:
RAD21 homolog (S. pombe) [Source:HGNC Symbol;Acc:9811]
Mouse Orthologue:
Rad21
Mouse Description:
RAD21 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:108016]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14114 Essential Splice Site Available for shipment Available now
sa44925 Nonsense Mutation detected in F1 DNA During 2017
sa10727 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Essential Splice Site 230 637 5 13
ENSDART00000132800 Essential Splice Site 230 637 6 14
Genomic Location (Zv9):
Chromosome 19 (position 45588408)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44486630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGACTTTGGAGACAATCCAATGGAGAGCACTGAAGGAGGCATGCTGG[G/A]TAATAGAGGCATCTATAATATYCYCCGMTGTATAGGCTTTRTGTGGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Nonsense 297 637 7 13
ENSDART00000132800 Nonsense 297 637 8 14
Genomic Location (Zv9):
Chromosome 19 (position 45584394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATTCTGGCCCTGTGGAGCCTTTGCCCACCATGACAGACCAGACTGAA[C/T]AGACCACACTAGTCCACAATGAAGAGGAGGCCTTTGCTTTGGAGCCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Nonsense 310 637 7 13
ENSDART00000132800 Nonsense 310 637 8 14
Genomic Location (Zv9):
Chromosome 19 (position 45584354)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44482576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGACTGAACAGACCACACTAGWCCACAATGAAGAGGAGGCCTTTGCTT[T/A]GGAGCCCATCGACATCAMAGGTCAGTCAGAAGAGAAAAGTAGTWGCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link