evla

Ensembl ID:
ENSDARG00000035650
ZFIN ID:
ZDB-GENE-000607-65
Description:
Enah/Vasp-like a [Source:RefSeq peptide;Acc:NP_955813]
Human Orthologue:
EVL
Human Description:
Enah/Vasp-like [Source:HGNC Symbol;Acc:20234]
Mouse Orthologue:
Evl
Mouse Description:
Ena-vasodilator stimulated phosphoprotein Gene [Source:MGI Symbol;Acc:MGI:1194884]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23116 Missense Mutation detected in F1 DNA During 2014
sa23115 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051697 None None 387 None 13
ENSDART00000125195 Missense 354 638 6 14
ENSDART00000138346 None None 212 None 6

The following transcripts of ENSDARG00000035650 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 30970329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAAGCCCTTCTGGAGGTCCTCTGCACCCACATTATCCCATACAAGAA[T/A]CGTCTTGCCCCCTTCCACCTCTCATTGGCCAGTCAGTCCAAGGCCCCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051697 Nonsense 371 387 12 13
ENSDART00000125195 Nonsense 622 638 13 14
ENSDART00000138346 None None 212 None 6

The following transcripts of ENSDARG00000035650 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 30960575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAAGGAGATCTTGGAGGAGGTCGTTCGTGAATTGCAGAAAGTAAAA[G/T]AGGAAATAATTGATGGTAGGTTTTGAGGAATCCAGGATTATTTAAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yzzs18zy