ext1c

Ensembl ID:
ENSDARG00000035649
ZFIN ID:
ZDB-GENE-050211-5
Description:
Exostoses (Multiple) 1c [Source:UniProtKB/TrEMBL;Acc:B8JKP1]
Human Orthologue:
EXTL1
Human Description:
exostoses (multiple)-like 1 [Source:HGNC Symbol;Acc:3515]
Mouse Orthologue:
Extl1
Mouse Description:
exostoses (multiple)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1888742]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23603 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051694 Nonsense 171 313 2 2
ENSDART00000136647 Nonsense 171 312 3 3
ENSDART00000138295 Nonsense 171 177 3 3
Genomic Location:
Chromosome 19 (position 49242155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGGGATCAGCTTTCCCAGCAGTTTGTGCCCAACGTTGATGAGCGGATT[C/T]GAGGATACCCACTTTGGAACGACGGTCGAAATCATGTCATCTTTAATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sgtch36u