si:ch211-89f7.3

Ensembl ID:
ENSDARG00000035633
ZFIN ID:
ZDB-GENE-030131-751
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BIR1]
Human Orthologue:
TCTN2
Human Description:
tectonic family member 2 [Source:HGNC Symbol;Acc:25774]
Mouse Orthologue:
Tctn2
Mouse Description:
tectonic family member 2 Gene [Source:MGI Symbol;Acc:MGI:1915228]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33549 Nonsense Available for shipment Available now
sa40369 Nonsense Mutation detected in F1 DNA During 2017
sa40370 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8615 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8441 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33550 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669   None 597 None 16
ENSDART00000135921 Nonsense 131 709 4 18
Genomic Location (Zv9):
Chromosome 5 (position 14609197)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12906634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGCAGTCTCCAGCTGTGTGGGAATGAAACCTCCATCTCGGACTGCTG[T/A]CTGGAGTTGCTTTGTGTCCAGGAGACTCTGCTTGTGTCTGCTTGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Nonsense 46 597 2 16
ENSDART00000135921 Nonsense 181 709 5 18
Genomic Location (Zv9):
Chromosome 5 (position 14612352)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12909789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATCATATCTTTTTGTGTTTTGCAGTAAATAAAACAGTCATTCCCAAC[C/T]AAGTATTTCAGCCGCTCGGCCAGTGCCCGTGTGACGTTTCTCCAGGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 252 597 6 16
ENSDART00000135921 Essential Splice Site 387 709 9 18
Genomic Location (Zv9):
Chromosome 5 (position 14617518)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12914955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGACAACATCAGATTATTTGTGTCAAATTCTCCTGAGGTCACTTCAGG[T/C]CAGTTATTCAGGTTAACATTTTGAGCAGTCACCAATTTTAAAATCTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
Genomic Location (Zv9):
Chromosome 5 (position 14618819)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12916256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCGCCATTGCTGTGACACGAACCACWGCAAACATCACTGTACCTGG[T/C]GAATATCACTCTCTCAATATAAAATACAGCTTTACTGCAYSTGCTTGTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
Genomic Location (Zv9):
Chromosome 5 (position 14618819)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12916256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCGCCATTGCTGTGACACGAACCACWGCAAACATCACTGTACCTGG[T/C]GAATATCACTCTCTCAATATAAAATACAGCTTTACTGCAYSTGCTTGTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 316 597 8 16
ENSDART00000135921   None 709 None 18
Genomic Location (Zv9):
Chromosome 5 (position 14618990)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12916427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGTGAATGGAAACGAGACCTCTCAGTCGTACTCCGGTAAGCCAA[C/A]ACAAATGATGTGAATTTGTATTTAGGAATGTAATGATATTTTTTATAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link