mtnr1c

Ensembl ID:
ENSDARG00000035609
ZFIN ID:
ZDB-GENE-990415-158
Description:
Melatonin receptor type 1C [Source:UniProtKB/Swiss-Prot;Acc:P51052]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20390 Nonsense Mutation detected in F1 DNA During 2014
sa9234 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051622 Nonsense 191 361 2 2
ENSDART00000121608 Nonsense 142 304 3 3
ENSDART00000128781 Nonsense 191 361 2 2
Genomic Location:
Chromosome 5 (position 24448671)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCGCGGGTTTTCTCCTGCACCTTCACCCAGACAGCGAGCTCTTCTTA[T/G]ACAGTCTGTGTTGTTCTGATCCACTTCCTTGTCCCGTTGGGTGTGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051622 Nonsense 236 361 2 2
ENSDART00000121608 Nonsense 187 304 3 3
ENSDART00000128781 Nonsense 236 361 2 2
Genomic Location:
Chromosome 5 (position 24448805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAGGGTTAAAGGACGCGTGCGGCCCAATCCAAAAGTCAGAGCGGCTGATT[T/A]GAGGAATTTCCTGACAATGTTTGTGGTGTTTGTGCTATTCGCYGTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kgj6f3k1